Analysis of the popABC and hrpY promoters through beta-galactosidase assays assays on w-t and hrpB- backgrounds using promoter fragments of different length identifies deletions that abolish induction by HrpB. Alignment of sequences from both promoters, combined with the beta-galactosidase evidence, indicates that they share a conserved TTCG-N16-TTCG motif, termed hrpII-box. Further beta-galactosidase assays on the hrpY promoter combined with site-directed mutagenesis (comparing intact and mutated promoters) validate the importance of the direct repeats and their precise spacing. In silico searches confirm these findings and extend the regulon to other genes.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type | 
|---|---|---|---|---|---|
| TTCGTACGCTTGCACAAGGTTTCG | 
          
          
 | 
        activator | not specified | ||
| TTCGCGTGCATGACCACGATTTCG | RS_RS21330, RS_RS21325, RS_RS21320 | 
          
          
 | 
        activator | not specified |