Curation Information

Publication: Characterization of the cis-acting regulatory element controlling HrpB-mediated activation of the type III secretion system and effector genes in Ralstonia solanacearum.;Cunnac S, Boucher C, Genin S;Journal of bacteriology 2004 Apr; 186(8):2309-18 [15060033]
TF: HrpB [P31778, view regulon]
Reported TF sp.: Ralstonia solanacearum GMI1000
Reported site sp.: Ralstonia solanacearum GMI1000
Created by: Erill Lab
Curation notes: -

Experimental Process

Analysis of the popABC and hrpY promoters through beta-galactosidase assays assays on w-t and hrpB- backgrounds using promoter fragments of different length identifies deletions that abolish induction by HrpB. Alignment of sequences from both promoters, combined with the beta-galactosidase evidence, indicates that they share a conserved TTCG-N16-TTCG motif, termed hrpII-box. Further beta-galactosidase assays on the hrpY promoter combined with site-directed mutagenesis (comparing intact and mutated promoters) validate the importance of the direct repeats and their precise spacing. In silico searches confirm these findings and extend the regulon to other genes.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TTCGTACGCTTGCACAAGGTTTCG
TTCGCGTGCATGACCACGATTTCG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TTCGTACGCTTGCACAAGGTTTCG			Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	not specified
TTCGCGTGCATGACCACGATTTCG	RS_RS21330, RS_RS21325, RS_RS21320		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. -	activator	not specified