Curation Information

Publication: Structural and functional characterization of the transcriptional repressor CsoR from Thermus thermophilus HB8.;Sakamoto K, Agari Y, Agari K, Kuramitsu S, Shinkai A;Microbiology (Reading, England) 2010 Jul; 156(Pt 7):1993-2005 [20395270]
TF: CsoR [Q5SHL1, view regulon]
Reported TF sp.: Thermus thermophilus HB8
Reported site sp.: Thermus thermophilus HB8
Created by: Erill Lab
Curation notes: -
External databases: NCBI GEO (GSE19521) http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE19521. Protein Data Bank (3AAI) .

Experimental Process

Visual inspection revealed a palindromic sequence resembling the known CsoR-binding motif upstream of the copZ-csoR-copA operon. The GGCG-TACCCCACCCCACCTGGGGTGGGGTA-GGAG fragment containing this palindrome was tested for CsoR-binding via DNA affinity purification on the streptavidin surface of a sensor chip. Repression by CsoR, and dependence on copper, of the copZ... operon was demonstrated by in vitro transcription of its cloned promoter. Copper- and csoR-dependence of copZ... operon was established in vivo by DNA array analysis using w-t and csoR mutants in the absence/presence of 1.25 mM CuSO4.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TACCCCACCCCACCTGGGGTGGGGTA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TACCCCACCCCACCTGGGGTGGGGTA	TTHA1718, TTHA1719, TTHA1720,		Experimental technique details DNA affinity purification (ECO:0005629) DNA affinity purification - ECO:0005629 In DNA affinity purification, DNA from promoter regions thought to be bound by the protein is labelled (e.g. biotinylated) and bound to beads (or some type of matrix). The protein is then left to interact with DNA and eventually eluted. Bound protein will remain attached to beads. This can be detected through gel electophoresis. The protein can then be sequenced by mass-spectrometry. The techinque can be used to demonstrate binding of a purified protein, or to purify the binding protein from crude extract or a mix of proteins. - Experimental technique details DNA-array expression analysis (ECO:0005525) DNA-array expression analysis - ECO:0005525 DNA-arrays (or DNA-chips or microarrays) are flat slabs of glass, silicon or plastic onto which thousands of multiple short single-stranded (ss) DNA sequences (corresponding to small regions of a genome) have been attached. After performing a mRNA extraction in induced and non-induced cells, the mRNA is again reverse transcribed, but here the reaction is tweaked, so that the emerging cDNA contains nucleotides marked with different fluorophores for controls and experiment. Targets will hybridize by base-pairing with those probes that resemble them the most. The array can then be stimulated by a laser and scanned for fluorescence at two different wavelengths (control and induced). The ratio or log-ratio between the two fluorescence intensities corresponds to the induction level. - Experimental technique details In-vitro transcription (ECO:0001204) In-vitro transcription - ECO:0001204 In-vitro transcription is often used to validate that a particular TF can or cannot activate/repress a gene in the absence of other proteins that are present in in vivo conditions. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	repressor	tetramer