Researchers first verified that site containing region was required for MC-induced expression of pnlA through a series of deletions and CAT reporter assays. They then performed EMSA with purified RdgB with a - 110 to +54 bp segment confirmed binding of RdgB. DNAse I protection assays further allowed pinning down the binding site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TTTTATTAAACTCGATTAATAAGC | PCC21_014030 |
|
activator | dimer |