Curation Information

Publication
Activation of the Erwinia carotovora subsp. carotovora pectin lyase structural gene pnlA: a role for RdgB.;Liu Y, Cui Y, Mukherjee A, Chatterjee AK;Microbiology (Reading, England) 1997 Mar; 143 ( Pt 3)():705-12 [9084157]
TF
RdgB [Q47588, view regulon]
Reported TF sp.
Erwinia carotovora subsp. carotovora Ecc71
Reported site sp.
Erwinia carotovora subsp. carotovora Ecc71
Created by
Erill Lab
Curation notes
-

Experimental Process

Researchers first verified that site containing region was required for MC-induced expression of pnlA through a series of deletions and CAT reporter assays. They then performed EMSA with purified RdgB with a - 110 to +54 bp segment confirmed binding of RdgB. DNAse I protection assays further allowed pinning down the binding site.

Transcription Factor Binding Sites


TTTTATTAAACTCGATTAATAAGC
TTTTATTAAACTCGATTAATAAGC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTTTATTAAACTCGATTAATAAGC PCC21_014030
... ... PCC21_014030
Experimental technique details CAT reporter gene assays (ECO:0005617) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - activator dimer