Curation Information

Publication: Regulation of the Salmonella typhimurium pepT gene by cyclic AMP receptor protein (CRP) and FNR acting at a hybrid CRP-FNR site.;Lombardo MJ, Lee AA, Knox TM, Miller CG;Journal of bacteriology 1997 Mar; 179(6):1909-17 [9068635]
TF: CRP [P0A2T6, view regulon]
Reported TF sp.: Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
Reported site sp.: Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
Created by: Patrick O'Neill
Curation notes: NOTE: THIS PAPER IS NOT TO BE INCLUDED SINCE ITS REPORTED SITE IS ARTIFICIAL.

Experimental Process

NOTE: THIS PAPER IS NOT TO BE INCLUDED SINCE ITS REPORTED SITE IS ARTIFICIAL. (1) Determination of binding by CRP to a hybrid CRP-FNR by primer extension and site directed mutagenesis. (2) Determination of regulation by beta-gal assay. Although both CRP and FNR are capable of binding the pepT promoter, CRP requires a mutation of the -10 element to the consensus sequence in order to activate transcription efficiently. Therefore, when both CRP and FNR are present in the wild-type, CRP effectively represses by excluding FNR and activating at a lower rate.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

AAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTATT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
AAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTATT	pepT,		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Primer Extension assay (ECO:0005657) Primer Extension assay - ECO:0005657 Primer Extension Assay is a simple method of assessing expression levels. The total RNA produced by the culture is isolated. A short synthetic oligonucleotide primer (complementary to a short sequence on the target RNA) is radiolabelled (usually with 32P) and the primer anneals to the RNA. Reverse transcriptase then extends the RNA producing cDNA. The cDNA is analyzed on a polyacrylamide gel. The amount of cDNA in a band on the gel is proportional to the amount of initial RNA, thus providing expression levels of RNA from the culture. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	dimer