fbpA Fur-binding sequence was used to identify putative Fur-binding sites in N. gonorrhoeae genome. Binding of the gonococcal Fur protein to the promoter regions of the identified genes was verified by EMSA.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type | 
|---|---|---|---|---|---|
| GAGATCTTAAGAAACGTCTTT | 
          
          
 | 
        activator | dimer | ||
| TATAATAGAAGATTGCAATTT | 
          
          
 | 
        activator | dimer |