Negative regulation of yciC expression by Zur was confirmed by using β-Galactosidase reporter assays. Zur-binding site within the yciC promoter region was localized by using a restriction enzyme protection assay. EMSAs confirmed binding of the purified Zur protein with its target operons.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TTTAAATCGTAATCATTCTA | yciC, |
|
repressor | dimer |