Curation Information

Publication
Identification of a zinc-specific metalloregulatory protein, Zur, controlling zinc transport operons in Bacillus subtilis.;Gaballa A, Helmann JD;Journal of bacteriology 1998 Nov; 180(22):5815-21 [9811636]
TF
Zur [P54479, view regulon]
Reported TF sp.
Bacillus subtilis subsp. subtilis str. 168
Reported site sp.
Bacillus subtilis subsp. subtilis str. 168
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Negative regulation of yciC expression by Zur was confirmed by using β-Galactosidase reporter assays. Zur-binding site within the yciC promoter region was localized by using a restriction enzyme protection assay. EMSAs confirmed binding of the purified Zur protein with its target operons.

Transcription Factor Binding Sites


TTTAAATCGTAATCATTCTA
TTTAAATCGTAATCATTCTA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTTAAATCGTAATCATTCTA yciC,
... ... yciC yczL yciB yciA yckA yckB
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - repressor dimer