Curation Information

Publication
Molecular characterization of transcriptional regulation of rovA by PhoP and RovA in Yersinia pestis.;Zhang Y, Gao H, Wang L, Xiao X, Tan Y, Guo Z, Zhou D, Yang R;PloS one 2011; 6(9):e25484 [21966533]
TF
RovA [B1JJ73, view regulon]
Reported TF sp.
Yersinia pestis biovar Microtus strain 201
Reported site sp.
Yersinia pestis biovar Microtus strain 201
Created by
Erill Lab
Curation notes
-

Experimental Process

rovA self-regulation assessed by beta-gal with w-t and rovA mutant. Sites verified by DNAse footprinting and EMSA with two separate fragments. Specific site locations inferred from comparative genomics with previously published sites in Y. pseudotuberculosis.

Transcription Factor Binding Sites


TGGGAGTTATGCTAGCACGCTAATTAAAAGGAGG
GGTATATATTGTCTATAGCAATTATATTATTTGAATTAATTTACATCCATTAATTATATTGAGTGTTAATTATATTATCTGCATGAATATA
TGGGAGTTATGCTAGCACGCTAATTAAAAGGAGG
GGTATATATTGTCTATAGCAATTATATTATTTGAATTAATTTACATCCATTAATTATATTGAGTGTTAATTATATTATCTGCATGAATATA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type