Curation Information

Publication
Identification of the fur-binding site in regulatory region of the vulnibactin-receptor gene in Vibrio vulnificus.;Lee HJ, Lee KH;Journal of microbiology and biotechnology 2012 Jan; 22(1):46-9 [22297218]
TF
Fur [P33117, view regulon]
Reported TF sp.
Vibrio vulnificus MO6-24/O
Reported site sp.
Vibrio vulnificus MO6-24/O
Created by
Erill Lab
Curation notes
-

Experimental Process

Site identified with DNAse footprinting. No conclusive evidence from lac fusions.

Transcription Factor Binding Sites


AATGCAAATGAGAATGCTTTACATTT
AATGCAAATGAGAATGCTTTACATTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type