Multiple fragments of the tcpP promoter assayed with beta-gal and EMSA to confim exp & binding. DNAse footprint used to refine the site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TTATGCAATCGAGTTCTCATTA | tcpP, |
|
repressor | dimer |