Curation Information

Publication
Overlapping binding sites for the virulence gene regulators AphA, AphB and cAMP-CRP at the Vibrio cholerae tcpPH promoter.;Kovacikova G, Skorupski K;Molecular microbiology 2001 Jul; 41(2):393-407 [11489126]
TF
CRP [O34015, view regulon]
Reported TF sp.
Vibrio cholerae O395
Reported site sp.
Vibrio cholerae O395
Created by
Erill Lab
Curation notes
-

Experimental Process

Multiple fragments of the tcpP promoter assayed with beta-gal and EMSA to confim exp & binding. DNAse footprint used to refine the site.

Transcription Factor Binding Sites


TTATGCAATCGAGTTCTCATTA
TTATGCAATCGAGTTCTCATTA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTATGCAATCGAGTTCTCATTA tcpP,
... ... tcpP tcpI tcpH
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - repressor dimer