Curation Information

Publication
Transcriptional control of toxT, a regulatory gene in the ToxR regulon of Vibrio cholerae.;Higgins DE, DiRita VJ;Molecular microbiology 1994 Oct; 14(1):17-29 [7830555]
TF
ToxR [A0A0H3AK48, view regulon]
Reported TF sp.
Vibrio cholerae O395
Reported site sp.
Vibrio cholerae O395
Created by
Elliot White
Curation notes
-

Experimental Process

ToxT expression and binding verified using primer extension, and EMSA + beta gal assays using three different fragments.

Transcription Factor Binding Sites


AAAAAACATAAAATAACATGAGTTACTTTATGTTTTT
AAAAAACATAAAATAACATGAGTTACTTTATGTTTTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type