Curation Information

Publication
Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter.;Kovacikova G, Skorupski K;Molecular microbiology 2002 Nov; 46(4):1135-47 [12421317]
TF
HapR [A0A0H3Q915, view regulon]
Reported TF sp.
Vibrio cholerae C6706
Reported site sp.
Vibrio cholerae C6706
Created by
Elliot White
Curation notes
-

Experimental Process

A HapR EMSA of AphA promoter fragments showed that HapR binds between -82 and -56. This result was confirmed via DNase I footprinting, which showed HapR protecting -83 -> -58/-85 -> -60 (top/bottom strand). Within this region, the authors found a 7 bp inverted repeat (with 2 mismatches) that could serve as the HapR binding site.

Transcription Factor Binding Sites


ATTATTGAGAATAATGTCAGTTTTTC
AAAACTGACATTATTCTCAATAATGA
ATTATTGAGAATAATGTCAGTTTTTC
AAAACTGACATTATTCTCAATAATGA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type