Curation Information

Publication
Regulatory effects of cAMP receptor protein (CRP) on porin genes and its own gene in Yersinia pestis.;Gao H, Zhang Y, Yang L, Liu X, Guo Z, Tan Y, Han Y, Huang X, Zhou D, Yang R;BMC microbiology 2011 Feb 23; 11():40 [21345179]
TF
CRP [Q7CFV3, view regulon]
Reported TF sp.
Yersinia pestis biovar Microtus strain 201
Reported site sp.
Yersinia pestis CO92
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

The expression levels of ompC and ompF were tested in Δcrp and WT by qRT-PCR and lacZ fusion assays in the presence of 1 mM cAMP. Both methods indicate that CRP positively resulates ompC, ompF. Primer extension assays were also conducted. The results of these assays were consistent with RT-PCR and lacZ experiments. A CRP-consensus like sequences were predicted by scanning a 300bp upstream DNA regions of ompC, F and X, with a CRP-consensus sequence and a cutoff score value of 7. DNase I footprinting with CRP protein in the presence of 2 mM cAMP protected a single distinct region upstream of each target gene against DNase I digestion in a dose-dependent pattern.

Transcription Factor Binding Sites


AAACAGTGAGTTATAGCACATAT
ACTTTGTGACTTAGATCGAATTT
AAACAGTGAGTTATAGCACATAT
ACTTTGTGACTTAGATCGAATTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
AAACAGTGAGTTATAGCACATAT ompC,
... ... ompC micF
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator not specified
ACTTTGTGACTTAGATCGAATTT ompF
... ... ompF
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator not specified