Regulation was shown by RT-PCR and GUS reporter assays. Specific regulation of xoo0804 abd xoo0803 expression by HrpX was confirmed by site-directed mutagenesis.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TTCGCTTAACGCGACCGGTCTGCGG | XOO_0804 |
|
activator | dimer | |
TTCGCCAAATCGCACATCGATTCTG | XOO_3803, |
|
activator | dimer |