DNA microarray analysis identified genes differentially expressed in the wild-type and the fur mutant strains. qRT-PCR validated Fur-dependent expression of some of the genes identified in the microarray analysis. Motif discovery tools identified a 21 bp Fur binding motif.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TAATGAGATTTGTTCTTATTT | omcA |
|
repressor | dimer |