Curation Information

Publication
The aldA gene of Escherichia coli is under the control of at least three transcriptional regulators.;Limón A, Hidalgo E, Aguilar J;Microbiology (Reading, England) 1997 Jun; 143 ( Pt 6)(6):2085-95 [9202484]
TF
CRP [P0ACJ8, view regulon]
Reported TF sp.
Escherichia coli K12 (Taxonomy ID: 83333)
Reported site sp.
Escherichia coli K12 (Taxonomy ID: 83333)
Created by
Patrick O'Neill
Curation notes
-

Experimental Process

(1) Demonstration of binding by EMSA and DNAse footprinting. (2) Demonstration of regulation by beta-gal reporter assay induced by cAMP.

Transcription Factor Binding Sites


TTTTATGAAGCCCTTCACAGAA
TTTTATGAAGCCCTTCACAGAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTTTATGAAGCCCTTCACAGAA
... ... ydcF aldA gapC
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - activator dimer