Curation Information

Publication: GbdR regulates Pseudomonas aeruginosa plcH and pchP transcription in response to choline catabolites.;Wargo MJ, Ho TC, Gross MJ, Whittaker LA, Hogan DA;Infection and immunity 2009 Mar; 77(3):1103-11 [19103776]
TF: GbdR [Q9HTI4, view regulon]
Reported TF sp.: Pseudomonas aeruginosa PAO1
Reported site sp.: Pseudomonas aeruginosa PAO1
Created by: Grace Chandler
Curation notes: -

Experimental Process

qRT-PCR measured plcH transcription to determine that it is positively regulated by GbdP. Deletion mapping identified the region necessary for GbdR-dependent regulation. LacZ fusion assays were used to analyze plcH promoter activity, demonstrating that the gbdR knockout mutant did not display induction. GFP assays were used to analyze the activity of the pchP promoter, showing that induction did not occur in the absence of GbdR. EMSA confirmed GbdR binding to the plcH and pchP promoters. Alignment of the plcH and pchP promoters identified the sequences necessary for GbdR regulation and binding. Site-directed mutagenesis was then used to further test the putative binding regions, demonstrating that the site was valid. Incubation of P. aeruginosa in mice lungs demonstrated GbdR regulation in-vivo and elucidating the subject of nosocomial P. aeruginosa infection in cystic fibrosis patients.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

GTTGTCGCTCAAGGTCATATCGAAGTCGCTTTCGGGA
GTTTGCGCTAGGGTCGTTGGTCGTTGCCTGTCGGGA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
GTTGTCGCTCAAGGTCATATCGAAGTCGCTTTCGGGA	plcH,		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	not specified
GTTTGCGCTAGGGTCGTTGGTCGTTGCCTGTCGGGA	pchP		Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	not specified