An aruC::LacZ fusion demonstrated that in the argR knockout strain, aruC expression is no longer induced. S1 nuclease protection demonstrated that aruC, the first gene in the operon of interest, was activated by an arginine-inducible promoter. EMSA was performed using purified ArgR protein and DNA fragments containing the car, argF and aruC regulatory regions, confirming ArgR binding. DNase I footprinting identified the binding region on both the car and argF promoters protected by ArgR, as well as the two binding regions on the aruC promoter. Multiple sequence alignment with the sequences obtained from the DNase experiments revealed an ArgR consensus binding motif.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
CGTCTTATTGGTGGACCGGAATGTCGCGATTCTGTAAACTAC | carA, |
|
not specified | dimer | |
AGGCGCGATCTTATAAGGAAATGTCGCGGAAACACAAGGAGG | argF, |
|
not specified | dimer | |
CTGCGCCTTCCCGATGCTTTCTGTCGCATTTCCGAAAGCCGC | aruC, |
|
activator | dimer |