Curation Information

Publication
Role of MexZ and PA5471 in transcriptional regulation of mexXY in Pseudomonas aeruginosa.;Yamamoto M, Ueda A, Kudo M, Matsuo Y, Fukushima J, Nakae T, Kaneko T, Ishigatsubo Y;Microbiology (Reading, England) 2009 Oct; 155(Pt 10):3312-21 [19589837]
TF
MexZ [G3XCU9, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Joe Sparenberg
Curation notes
-

Experimental Process

EMSA revealed that MexZ binds to a 20bp palindromic sequence to the promoter region of the mexXY operon. EMSA and Western Blot showed higher levels of MexX and MexZ in the presence of tetracycline. Plasmid-borne MexZ repressed drug-induced MexX production confirming that MexZ acts as a repressor of the mexXY operon. EMSA and in vitro transcription assays revealed the interaction between PA5471 and MexZ reduces MexZ DNA-binding ablility, leading to mexXY transcription.

Transcription Factor Binding Sites


ATTAATTAATCACTCATGATTGATTAT
ATTAATTAATCACTCATGATTGATTAT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type