Curation Information

Publication
Cloning, sequence and mutagenesis of the structural gene of Pseudomonas aeruginosa CysB, which can activate algD transcription.;Delic-Attree I, Toussaint B, Garin J, Vignais PM;Molecular microbiology 1997 Jun; 24(6):1275-84 [9218775]
TF
CysB [G3XCU6, view regulon]
Reported TF sp.
Pseudomonas aeruginosa CHA
Reported site sp.
Pseudomonas aeruginosa CHA
Created by
Grace Chandler
Curation notes
-

Experimental Process

EMSA using DNA fragments of different sizes was used to confirm binding and localize the CysB binding site on the algD promoter. An algD-xylE fusion in wild type and cysB mutant strains demonstrated that CysB acts as an activator of algD expression.

Transcription Factor Binding Sites


TGTTGAAATTAAAGGCCTTTAGAAACTTGAATTCTATGGACCGAAC
TGTTGAAATTAAAGGCCTTTAGAAACTTGAATTCTATGGACCGAAC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type