Consensus search upstream of the oprD start codon revealed a putative binding sequence. EMSA of the oprD upstream region demonstrated AlgR binding to this region. DNase I footprinting revealed that ArgR protected a 47 bp region containing the predicted binding site. RNA dot blot identified that ArgR activated the expression of oprD in response to exogenous arginine. Multiple sequence alignment was used to derive a consensus binding sequence for ArgR.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
CGCACCTACGCAGATGCGACATGCGTCATGCAATTTTGCGACA | oprD, |
|
activator | not specified |