Curation Information

Publication
Two levels of cooperativeness in the binding of TodT to the tod operon promoter.;Lacal J, Guazzaroni ME, Gutiérrez-del-Arroyo P, Busch A, Vélez M, Krell T, Ramos JL;Journal of molecular biology 2008 Dec 31; 384(5):1037-47 [18950641]
TF
TodT [I7CA98, view regulon]
Reported TF sp.
Pseudomonas putida DOT-T1E
Reported site sp.
Pseudomonas putida DOT-T1E
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

EMSA with a 352-bp todX promoter fragment showed that up to four different complexes were formed. A series of ITC assays further verified binding of TodT to todX promoter region. Beta-galactosidase assays showed that mutagenesis of both half-palindromes resulted in an almost 12-fold decrease in transcriptional activity.

Transcription Factor Binding Sites


GCATAAACCATCGTTTATCA
AGTTAAACTTTGGTTTTCTA
ATATAAACCCATAAGCCAAA
GCATAAACCATCGTTTATCA
AGTTAAACTTTGGTTTTCTA
ATATAAACCCATAAGCCAAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type