Curation Information

Publication
Cyclic AMP receptor protein is a repressor of adenylyl cyclase gene cyaA in Yersinia pestis.;Qu S, Zhang Y, Liu L, Wang L, Han Y, Yang R, Zhou D, Liu M;Canadian journal of microbiology 2013 May; 59(5):304-10 [23647342]
TF
CRP [Q7CFV3, view regulon]
Reported TF sp.
Yersinia pestis biovar Microtus strain 201
Reported site sp.
Yersinia pestis biovar Microtus strain 201
Created by
Joe Sparenberg
Curation notes
-

Experimental Process

Ad-hoc quantitative phenotype observation, primer extension, and lacZ assays showed that CRP represses the cyaA gene. Primer extension, EMSA, and DNase I footprinting determined the CRP binding site of the cyaA gene.

Transcription Factor Binding Sites


GGCAAGGTGTTAGATTGATCACGTTTCCAGCA
GGCAAGGTGTTAGATTGATCACGTTTCCAGCA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GGCAAGGTGTTAGATTGATCACGTTTCCAGCA cyaA,
... ... cyaA YP_3198 hemC hemD hemX hemY2
Experimental technique details Ad-hoc quantitative phenotype observation (ECO:0005676) - Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - repressor not specified