Curation Information

Publication: The alternative oxidase (AOX) gene in Vibrio fischeri is controlled by NsrR and upregulated in response to nitric oxide.;Dunn AK, Karr EA, Wang Y, Batton AR, Ruby EG, Stabb EV;Molecular microbiology 2010 Jul 1; 77(1):44-55 [20487270]
TF: NsrR [Q5E2D6, view regulon]
Reported TF sp.: Vibrio fischeri ES114
Reported site sp.: Vibrio fischeri ES114
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

aox transcription start site was determined by primer extension analysis. NsrR-mediated repression of aox was confirmed by comparing aox-lacZ expression levels in the wild type V. fischeri ES114 and the nsrR mutant strains. The results of this assay showed that Paox-lacZ activity was approximately 290-fold higher in the nsrR mutant strain. A putative NsrR binding site in the aox promoter was predicted by in silico analysis in a previous study. Site-directed mutagenesis of the NsrR binding site abolished NsrR-mediated repression as shown by aox-lacZ reported assays.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TTAATTAAAGGTGTATTTTAAATGCAACTTTAATTAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TTAATTAAAGGTGTATTTTAAATGCAACTTTAATTAA	aox,		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	repressor	not specified