aox transcription start site was determined by primer extension analysis. NsrR-mediated repression of aox was confirmed by comparing aox-lacZ expression levels in the wild type V. fischeri ES114 and the nsrR mutant strains. The results of this assay showed that Paox-lacZ activity was approximately 290-fold higher in the nsrR mutant strain. A putative NsrR binding site in the aox promoter was predicted by in silico analysis in a previous study. Site-directed mutagenesis of the NsrR binding site abolished NsrR-mediated repression as shown by aox-lacZ reported assays.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TTAATTAAAGGTGTATTTTAAATGCAACTTTAATTAA | aox, |
|
repressor | not specified |