Microarray analyses identified LuxR-regulated genes by comparing expression profile of a luxO-aphA- strain to that of a luxO-aphA-luxR- strain. qRT-PCR performed in wild-type and luxR mutant strains showed that LuxR activated qrr4 expression. EMSA confirmed that LuxR binds to the qrr4 promoter. LuxR binding site was identified in a different study (PMID: 18681939).
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TTCTGATAAATGTATTAGTAG | VIBHAR_06697, |
|
activator | not specified |