Curation Information

Publication: Identification of a distantly located regulatory element in the luxD gene required for negative autoregulation of the Vibrio fischeri luxR gene.;Shadel GS, Baldwin TO;The Journal of biological chemistry 1992 Apr 15; 267(11):7690-5 [1560004]
TF: LuxR [B5EV73, view regulon]
Reported TF sp.: Vibrio fischeri MJ11
Reported site sp.: Vibrio fischeri MJ11
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

A deletion analysis of the luxICD region identified LuxR binding region. Visual inspection of this 56 bp region identified a 20 bp sequence similar to the lux consensus. Deletion of this site by site-directed mutagenesis resulted in increased expression of luxR compared to the expression levels in the strain containing the wild type operator. The ability of luxD element to bind LuxR was demonstrated by the ability of LuxR to activate luxICDABEG operon transcription from a luxICDABEG operon reporter plasmid in which the wild-type lux operator was replaced with the luxD element. In the presence of autoinducer, LuxR was able to activate luxI operon transcription from this luxD element containing reporter vector.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

GAATGGATCATTTTGCAGGT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
GAATGGATCATTTTGCAGGT			Experimental technique details Ad-hoc quantitative phenotype observation (ECO:0005676) Ad-hoc quantitative phenotype observation - ECO:0005676 A quantifiable phenotypic trait (e.g. glucose intake) is assessed in a quantitative manner after induction of the regulatory mechanism and used as a natural reporter.. The observable phenotypic trait should be described in the experimental notes. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	repressor	not specified