The vpsT and aphA promoters were shown to be inducible with c-di-GMP using lux assays. Sites for Lrp, HapR and VpsR were predicted by comparison to known consensus. The transcriptional start site of vpsT was determined with RACE PCR. EMSAs with multiple size fragments confirmed that the VpsR sites were located upstream of -119 from TSS. Expression assays with vpsR and hapR mutants using multiple size fragments also showed that it they are required for induction of both promoters and that the predicted sites are likely responsible for such induction.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TATTGAGAATAATGTCAGTTT | VCD_001716 |
|
repressor | monomer | |
TATTGATATTCTTAATATTGA | VCD_000383, |
|
repressor | monomer |