Curation Information

Publication
Transcriptional regulatory cascade for elastase production in Vibrio vulnificus: LuxO activates luxT expression and LuxT represses smcR expression.;Roh JB, Lee MA, Lee HJ, Kim SM, Cho Y, Kim YJ, Seok YJ, Park SJ, Lee KH;The Journal of biological chemistry 2006 Nov 17; 281(46):34775-84 [16971386]
TF
LuxT [Q7MFA2, view regulon]
Reported TF sp.
Vibrio vulnificus MO6-24/O
Reported site sp.
Vibrio vulnificus MO6-24/O
Created by
Erill Lab
Curation notes
-

Experimental Process

LuxT was identified as binding the smcR promoter through SDS-PAGE. EMSAs confirmed that it binds specifically and DNAse footprint identified a protected region with sequence AGTGCAATACGCTATTTACTATCACA. A luxT- mutant was shown to induce smcR expression through Western blot and luciferase reporter.

Transcription Factor Binding Sites


AGTGCAATACGCTATTTACTATCACA
AGTGCAATACGCTATTTACTATCACA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type