pilA1-lacZ fusions in the wild-type SM1021 and the Sm1021 ExpR+ strains revealed ExpR-mediated repression of pilA1 in the presence of an acyl homoserine lactone. EMSA confirmed that AHL-activated ExpR binds to the pilA1 promoter. DNase I footprinting identified a 28-bp region protected by ExpR. The protected sequence was aligned with four previously identified ExpR binding sites. This confirmed that ExpR bound to an ExpR consensus in the pilA1 promoter.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
CCCCCGCTAAATTCAGGGTA | pilA1, |
|
repressor | not specified |