Curation Information

Publication: Novel Sinorhizobium meliloti quorum sensing positive and negative regulatory feedback mechanisms respond to phosphate availability.;McIntosh M, Meyer S, Becker A;Molecular microbiology 2009 Dec; 74(5):1238-56 [19889097]
TF: ExpR [Q92L12, view regulon]
Reported TF sp.: Sinorhizobium meliloti 2011
Reported site sp.: Sinorhizobium meliloti 2011
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

sinR-gfp fusion assays in the wild-type and expR mutant strains revealed that sinR expression is reduced by the presence of AHL-activated ExpR. EMSA confirmed that ExpR bound to the sinR promoter region. By visual inspection of the sinR promoter, the researchers identified a 20-bp region homologous to the previously identified ExpR binding sites. The putative ExpR binding site was confirming by performing EMSA with a 34-bp fragment containing the predicted 20-bp site.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

AACCATGTTTATTATAGGGGCA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
AACCATGTTTATTATAGGGGCA	sinR		Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	repressor	not specified