FleQ - UniProtKB: G3XCV0 regulon and binding site collection of Pseudomonas aeruginosa PAO1


Sites are listed as curated.

CATTAGATTGACGTTAATC
CGCCTAAAAATTGACAGTT
CGCCTAAAAATTGACAGTT
CATTAGATTGACGTTAATC

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AGTCATTAGATTGACGTTAATC
CGCCTAAAAATTGACAGTTTCC
CGCCTAAAAATTGACAGTTTCC
AGTCATTAGATTGACGTTAATC

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

Site sequence Experimental techniques Gene regulation Curations PMIDs
CATTAGATTGACGTTAATC Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Site directed mutagenesis (ECO:0005667) pelA (PA3064) , pelB (PA3063) , pelC (PA3062) , pelD (PA3061) , pelE (PA3060) , pelF (PA3059) , pelG (PA3058) , PA3057 , PA3056 , PA3055 , PA3054 , PA3065 , PA3066 , PA3067 , gdhB (PA3068)
... ... pelA pelB pelC pelD pelE pelF pelG PA3057 PA3056 PA3055 PA3054 PA3065 PA3066 PA3067 gdhB
413 22581773
CGCCTAAAAATTGACAGTT Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Site directed mutagenesis (ECO:0005667) pelA (PA3064) , PA3065 , PA3054 , PA3055 , PA3056 , PA3057 , pelG (PA3058) , pelF (PA3059) , pelE (PA3060) , pelD (PA3061) , pelC (PA3062) , pelB (PA3063) , PA3066 , PA3067 , gdhB (PA3068)
... ... pelA PA3065 PA3054 PA3055 PA3056 PA3057 pelG pelF pelE pelD pelC pelB PA3066 PA3067 gdhB
413 22581773
CGCCTAAAAATTGACAGTT Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Site directed mutagenesis (ECO:0005667) pelA (PA3064) , pelB (PA3063) , pelC (PA3062) , pelD (PA3061) , pelE (PA3060) , pelF (PA3059) , pelG (PA3058) , PA3057 , PA3056 , PA3055 , PA3054 , PA3065 , PA3066 , PA3067 , gdhB (PA3068)
... ... pelA pelB pelC pelD pelE pelF pelG PA3057 PA3056 PA3055 PA3054 PA3065 PA3066 PA3067 gdhB
414 22581773
CATTAGATTGACGTTAATC Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Site directed mutagenesis (ECO:0005667) pelA (PA3064) , pelB (PA3063) , pelC (PA3062) , pelD (PA3061) , pelE (PA3060) , pelF (PA3059) , pelG (PA3058) , PA3057 , PA3056 , PA3055 , PA3054 , PA3065 , PA3066 , PA3067 , gdhB (PA3068)
... ... pelA pelB pelC pelD pelE pelF pelG PA3057 PA3056 PA3055 PA3054 PA3065 PA3066 PA3067 gdhB
414 22581773

All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.


Sites are listed as curated.

CATTAGATTGACGTTAATC
CGCCTAAAAATTGACAGTT
CGCCTAAAAATTGACAGTT
CATTAGATTGACGTTAATC

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AGTCATTAGATTGACGTTAATC
CGCCTAAAAATTGACAGTTTCC
CGCCTAAAAATTGACAGTTTCC
AGTCATTAGATTGACGTTAATC
Download data in FASTA format.
Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
Download raw data in TSV format. All reported sites are exported individually.
Download data in Attribute-Relation File Format (ARFF).
Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.