Fur , Fur regulon and binding site collection in Helicobacter pylori 26695 , Helicobacter pylori HPAG1

Fur - UniProtKB: Q1CU85 regulon and binding site collection of Helicobacter pylori 26695

Sites are listed as curated.

AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAA

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAA

Motif structure	Direct repeat
GC-content	16.28%
Regulatory mode	Activation	Repression	Dual	Not specified
Regulatory mode	0%	0%	0%	100%
TF conformation	Monomer	Dimer	Tetramer	Other	Not specified
TF conformation	0%	0%	0%	0%	100%
Binding site type	Motif-associated	Variable-motif-associated	Non-motif-associated
Binding site type	1	0	0

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

Genome	TF	TF conformation	Site sequence	Site location	Experimental techniques	Gene regulation	Curations	PMIDs
NC_000915.1	Q1CU85	not specified	AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAA	-[399098:399140]	Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific - Experimental technique details RNAse protection (ECO:0000288) RNAse protection - ECO:0000288 This is a technique used to detect typically mRNA with greater precision than Northern blot or RT-PCR. Therefore, it is commonly used to assess gene expression (specifically transcription). RNAse protection uses labelled RNA probes to bind desired targets. RNAses are then added to the mix and degrade all RNA that is not bound to probes. The remaining RNA is typically run on a gel to detect the size (and label) of the probe and determine which RNA it is. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge	HP0389 , HP0388 , HP0390	701	19399190

Fur - UniProtKB: Q1CU85 regulon and binding site collection of Helicobacter pylori HPAG1

Sites are listed as curated.

AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAC

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAC

Motif structure	Direct repeat
GC-content	18.60%
Regulatory mode	Activation	Repression	Dual	Not specified
Regulatory mode	0%	0%	0%	100%
TF conformation	Monomer	Dimer	Tetramer	Other	Not specified
TF conformation	0%	0%	0%	0%	100%
Binding site type	Motif-associated	Variable-motif-associated	Non-motif-associated
Binding site type	1	0	0

Genome	TF	TF conformation	Site sequence	Site location	Experimental techniques	Gene regulation	Curations	PMIDs
NC_008086.1	Q1CU85	not specified	AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAC	+[1058472:1058514]	Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific - Experimental technique details RNAse protection (ECO:0000288) RNAse protection - ECO:0000288 This is a technique used to detect typically mRNA with greater precision than Northern blot or RT-PCR. Therefore, it is commonly used to assess gene expression (specifically transcription). RNAse protection uses labelled RNA probes to bind desired targets. RNAses are then added to the mix and degrade all RNA that is not bound to probes. The remaining RNA is typically run on a gel to detect the size (and label) of the probe and determine which RNA it is. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge	HPAG1_1003 , HPAG1_1002 , HPAG1_1004	703	19399190

All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.

Sites are listed as curated.

AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAA
AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAC

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAA
AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAC

To generate the weblogo, aligned binding sites are used.

	Download data in FASTA format.
	Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
	Download raw data in TSV format. All reported sites are exported individually.
	Download data in Attribute-Relation File Format (ARFF).
	Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
	Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
	Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.