Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001790
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACTGATGATATATACAGGT - [4577939, 4577958] 16264194 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 69

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... hsdM hsdS symE symR
Gene Locus tag Description
hsdM b4349 DNA methyltransferase M
hsdS b4348 specificity determinant for hsdM and hsdR
symE b4347 toxic peptide regulated by antisense sRNA symR
symR b4625 ncRNA