Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000018c0
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACTCTATATTACCCCAGTT - [1585354, 1585373] 16264194 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 69

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ydeR ydeS ydeP ydeQ ydeT
Gene Locus tag Description
ydeR b1503 predicted fimbrial-like adhesin protein
ydeS b1504 predicted fimbrial-like adhesin protein
ydeP b1501 predicted oxidoreductase
ydeQ b1502 predicted fimbrial-like adhesin protein
ydeT b1505 pseudo