Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000025c0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
LexA [UniProtKB:P37452, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CACTGGATAAAAACACAGAG + [3367876, 3367895] 15458417 Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 129

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lexA PA3008 psrA PA3009
Gene Locus tag Description
lexA PA3007 LexA repressor
PA3008 PA3008 hypothetical protein
psrA PA3006 transcriptional regulator PsrA
PA3009 PA3009 hypothetical protein