Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000047b0
Genome
Vibrio parahaemolyticus - NC_004605.1
TF
OpaR [UniProtKB:Q79YV4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GACTAACTCAATTGTTAATA - [1728276, 1728295] 22506036 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - 208

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VPA1623 VPA1622 VPA1624
Gene Locus tag Description
VPA1623 VPA1623 transcriptional regulator MalT
VPA1622 VPA1622 hypothetical protein
VPA1624 VPA1624 hypothetical protein