Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000047c0
Genome
Vibrio parahaemolyticus - NC_004605.1
TF
OpaR [UniProtKB:Q79YV4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGTTTATTAATCAATCATTA + [1315403, 1315422] 22506036 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - 208

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VPA1240 VPA1241
Gene Locus tag Description
VPA1240 VPA1240 magnesium transporter MgtE
VPA1241 VPA1241 hypothetical protein