Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000047d0
Genome
Vibrio parahaemolyticus - NC_004605.1
TF
OpaR [UniProtKB:Q79YV4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGCTGAGAAAGTGATTAGTA + [200414, 200433] 22506036 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - 208

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VPA0199 VPA0200
Gene Locus tag Description
VPA0199 VPA0199 hemolysin secretion protein HylB
VPA0200 VPA0200 hypothetical protein