Site information for: Arc in species Enterobacteria phage P22; genome accession: NC

Transcription Factor Binding Site Information

dbxref: CollecTF:EXPSITE_0000f140
Genome: Enterobacteria phage P22 - NC_002371.2
TF: Arc [UniProtKB:A8CG91, view regulon]

Supporting Evidence

Binding site	Location	Publication	Experimental techniques used	Curation
ATAGTAGAGTGCTTCTATCAT	- [14798, 14818]	8107872	Experimental technique details X-ray crystallography (ECO:0005670) X-ray crystallography - ECO:0005670 X-ray crystallography is a method to determine the molecular structure of a crystal that is typically used to probe at the tridimensional structure of proteins. In some cases, it is possible to co-crystallize the protein bound to its DNA binding site, providing detail on the particular arrangement of the two components. Doing so provides, obviously, unequivocal evidence of binding. -	618

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Gene	Locus tag	Description
mnt	P22gp15	Mnt
orf59a	P22gp16	hypothetical protein
ant	P22gp17	Ant
arc	P22gp18	Arc