Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021fa0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
LasR [UniProtKB:P54292, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACCTACCAGATCTGGGGTTG + [5810146, 5810165] 22262098 Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 780

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rmlB rmlD rmlA rmlC PA5165 PA5166
Gene Locus tag Description
rmlB PA5161 dTDP-D-glucose 4,6-dehydratase
rmlD PA5162 dTDP-4-dehydrorhamnose reductase
rmlA PA5163 glucose-1-phosphate thymidylyltransferase
rmlC PA5164 dTDP-4-dehydrorhamnose 3,5-epimerase
PA5165 PA5165 two-component sensor
PA5166 PA5166 two-component response regulator