LasR - UniProtKB: P54292 regulon and binding site collection of Pseudomonas aeruginosa PAO1


Sites are listed as curated.

TCCTGTGAAATCTGGCAGTT
TCCTGTGAAATCTGGCAGTT
CCTGTGAATTCCGGTAGTT
ACCTACCAGATCTGGGGTTG
TCCTGCATGAATTGGTAGGC
TCCTGTGAAATCTGGCAGTT

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

TCCTGTGAAATCTGGCAGTT
TCCTGTGAAATCTGGCAGTT
ACCTGTGAATTCCGGTAGTT
ACCTACCAGATCTGGGGTTG
GCCTACCAATTCATGCAGGA
TCCTGTGAAATCTGGCAGTT

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

    Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
    NC_002516.2 P54292 dimer TCCTGTGAAATCTGGCAGTT -[3893268:3893287] Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) rhlA (PA3479) , rhlB (PA3478) , rhlR (PA3477) , PA3480 , PA3481 , metG (PA3482) , PA3483 , PA3484 , PA3485
    ... ... rhlA rhlB rhlR PA3480 PA3481 metG PA3483 PA3484 PA3485
    418 14526008
    NC_002516.2 P54292 dimer TCCTGTGAAATCTGGCAGTT -[3893268:3893287] Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) rhlA (PA3479) , rhlB (PA3478) , rhlR (PA3477) , PA3480 , PA3481 , metG (PA3482) , PA3483 , PA3484 , PA3485
    ... ... rhlA rhlB rhlR PA3480 PA3481 metG PA3483 PA3484 PA3485
    419 14526008
    NC_002516.2 P54292 not specified CCTGTGAATTCCGGTAGTT -[1224390:1224408] Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details RNAse protection (ECO:0000288) PA1131 , rhlC (PA1130) , PA1132
    ... ... PA1131 rhlC PA1132
    734 11359576
    NC_002516.2 P54292 not specified ACCTACCAGATCTGGGGTTG +[5810145:5810164] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) rmlB (PA5161) , rmlD (PA5162) , rmlA (PA5163) , rmlC (PA5164) , PA5165 , PA5166
    ... ... rmlB rmlD rmlA rmlC PA5165 PA5166
    780 22262098
    NC_002516.2 P54292 not specified TCCTGCATGAATTGGTAGGC -[2905653:2905672] Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) lecA (PA2570)
    ... ... lecA
    783 11053384
    NC_002516.2 P54292 not specified TCCTGTGAAATCTGGCAGTT -[3893268:3893287] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) rhlA (PA3479) , rhlB (PA3478) , rhlR (PA3477)
    ... ... rhlA rhlB rhlR
    823 24935161

    LasR - UniProtKB: P54292 regulon and binding site collection of Pseudomonas aeruginosa UCBPP-PA14


    Sites are listed as curated.

    CTGTGAGATCTGGGAG

    Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

    CTGTGAGATCTGGGAG

    For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

      Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
      NC_008463.1 P54292 not specified CTGTGAGATCTGGGAG -[4571843:4571858] Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) pqsA (PA14_51430) , pqsB (PA14_51420) , pqsC (PA14_51410) , pqsD (PA14_51390) , pqsE (PA14_51380) , phnA (PA14_51360) , phnB (PA14_51350) , mvfR (PA14_51340) , ogt (PA14_51440) , cupC3 (PA14_51450) , cupC2 (PA14_51460) , cupC1 (PA14_51470)
      ... ... pqsA pqsB pqsC pqsD pqsE phnA phnB mvfR ogt cupC3 cupC2 cupC1
      417 16735731

      All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.


      Sites are listed as curated.

      CTGTGAGATCTGGGAG
      TCCTGTGAAATCTGGCAGTT
      TCCTGTGAAATCTGGCAGTT
      CCTGTGAATTCCGGTAGTT
      ACCTACCAGATCTGGGGTTG
      TCCTGCATGAATTGGTAGGC
      TCCTGTGAAATCTGGCAGTT

      Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

      AACTGTGAGATCTGGGAGGC
      TCCTGTGAAATCTGGCAGTT
      TCCTGTGAAATCTGGCAGTT
      ACCTGTGAATTCCGGTAGTT
      ACCTACCAGATCTGGGGTTG
      GCCTACCAATTCATGCAGGA
      TCCTGTGAAATCTGGCAGTT
      Download data in FASTA format.
      Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
      Download raw data in TSV format. All reported sites are exported individually.
      Download data in Attribute-Relation File Format (ARFF).
      Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
      Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
      Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.