Curation Information

Publication
Mechanism of Pseudomonas aeruginosa RhlR transcriptional regulation of the rhlAB promoter.;Medina G, Juárez K, Valderrama B, Soberón-Chávez G;Journal of bacteriology 2003 Oct; 185(20):5976-83 [14526008]
TF
LasR [P54292, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Erill Lab
Curation notes
-

Experimental Process

Site identified by similarity to LasR consensus. Binding verified by EMSA. Effect on expression analyzed by beta-gal assays

Transcription Factor Binding Sites


TCCTGTGAAATCTGGCAGTT
TCCTGTGAAATCTGGCAGTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TCCTGTGAAATCTGGCAGTT rhlA, rhlB,
... ... rhlA rhlB rhlR PA3480 PA3481 metG PA3483 PA3484 PA3485
Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - activator dimer