Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021ff0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
LasR [UniProtKB:P54292, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCCTGCATGAATTGGTAGGC - [2905654, 2905673] 11053384 Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 783

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lecA
Gene Locus tag Description
lecA PA2570 LecA