Site information for: LasR in species Pseudomonas aeruginosa; genome accession: NC

Transcription Factor Binding Site Information

dbxref: CollecTF:EXPSITE_00021ff0
Genome: Pseudomonas aeruginosa - NC_002516.2
TF: LasR [UniProtKB:P54292, view regulon]

Supporting Evidence

Binding site	Location	Publication	Experimental techniques used	Curation
TCCTGCATGAATTGGTAGGC	- [2905654, 2905673]	11053384	Experimental technique details Luciferase reporter assay (ECO:0005648) Luciferase reporter assay - ECO:0005648 A type of reporter assay . The idea is identical to a betagalactosidase assay, but here fluorescence of luciferase gene product is used as the reporter. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. -	783

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Gene	Locus tag	Description
lecA	PA2570	LecA