Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00022e60
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
BrlR [UniProtKB:Q9HUT5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGACCTTGCCCCAGGGGCAATCCGTAGT + [5473709, 5473736] 24612375 Experimental technique details Beta-gal reporter assay - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 826

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA4878 PA4877
Gene Locus tag Description
PA4878 PA4878 transcriptional regulator
PA4877 PA4877 hypothetical protein