Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00024130
Genome
Yersinia pestis - NC_005810.1
TF
OxyR [UniProtKB:Q7CL10, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGGTTAATGTGACTTGTTCAATAATTTCATTCTA + [477294, 477327] 24577613 Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - 865

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... YP_0451 terZ YP_0450 YP_0449 YP_0448 citE1 terA terB terC1 terD
Gene Locus tag Description
YP_0451 YP_0451 hypothetical protein
terZ YP_0452 tellurium resistance protein
YP_0450 YP_0450 hypothetical protein
YP_0449 YP_0449 hypothetical protein
YP_0448 YP_0448 hypothetical protein
citE1 YP_0447 ATP/GTP-binding protein
terA YP_0453 tellurite resistance protein
terB YP_0454 tellurite resistance protein
terC1 YP_0455 tellurium resistance protein
terD YP_0456 tellurium resistance protein