Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00024fb0
Genome
Vibrio vulnificus - NC_005140.1
TF
CRP [UniProtKB:Q7M7I9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTGAGATGACTGTCCCATTT - [1611994, 1612013] 12947096 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - 877

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VVA1465
Gene Locus tag Description
VVA1465 VVA1465 Zinc metalloprotease, vibriolysin