Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00025020
Genome
Vibrio vulnificus - NC_005140.1
TF
CRP [UniProtKB:Q7M7I9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTAAATAAGTTGCTTTTTACGA - [1798031, 1798052] 16573699 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Primer Extension assay (ECO:0005657) - 883

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VVA1644 VVA1645 VVA1643 VVA1642 VVA1641 VVA1640
Gene Locus tag Description
VVA1644 VVA1644 bifunctional proline dehydrogenase/pyrroline-5-carboxylate dehydrogenase
VVA1645 VVA1645 AraC family transcriptional regulator
VVA1643 VVA1643 hypothetical protein
VVA1642 VVA1642 sodium/proline symporter
VVA1641 VVA1641 hypothetical protein
VVA1640 VVA1640 hypothetical protein