Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00025060
Genome
Vibrio vulnificus - NC_005139.1
TF
CRP [UniProtKB:Q7M7I9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACTTTGAAACAACTTGCGACAC - [2868963, 2868985] 18713737 Experimental technique details EMSA (ECO:0001807) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - 885

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VV2808
Gene Locus tag Description
VV2808 VV2808 DNA-directed RNA polymerase, sigma subunit