Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000251f0
Genome
Aliivibrio fischeri - NC_006840.2
TF
LuxR [UniProtKB:P35327, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACCTGTAAAATCTATCAGTT + [1945240, 1945259] 18083819 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 897

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VF_1725
Gene Locus tag Description
VF_1725 VF_1725 secretory tripeptidyl aminopeptidase