LuxR regulon and binding site collection in Vibrio fischeri ES114

LuxR - UniProtKB: P35327 regulon and binding site collection of Vibrio fischeri ES114

Sites are listed as curated.

AACTGTAAAATCGGACAGGT
ACCTGTAAAATCTATCAGTT
TCCTGTAGTTTATTGCGGCT
AAGTGTATATATTTACAGTT
ACCTGTAATAAACGACAGGA

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AACTGTAAAATCGGACAGGT
ACCTGTAAAATCTATCAGTT
AGCCGCAATAAACTACAGGA
AACTGTAAATATATACACTT
ACCTGTAATAAACGACAGGA

Motif structure	Inverted repeat
GC-content	35.00%
Regulatory mode	Activation	Repression	Dual	Not specified
Regulatory mode	100%	0%	0%	0%
TF conformation	Monomer	Dimer	Tetramer	Other	Not specified
TF conformation	0%	0%	0%	0%	100%
Binding site type	Motif-associated	Variable-motif-associated	Non-motif-associated
Binding site type	5	0	0

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

Genome	TF	TF conformation	Site sequence	Site location	Experimental techniques	Gene regulation	Curations	PMIDs
NC_006840.2	P35327	not specified	AACTGTAAAATCGGACAGGT	+[1287499:1287518]	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site.	VF_1161 , VF_1162 , VF_1163 , VF_1164 , macB (VF_1165)	897	18083819
NC_006840.2	P35327	not specified	ACCTGTAAAATCTATCAGTT	+[1945239:1945258]	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site.	VF_1725	897	18083819
NC_006840.2	P35327	not specified	TCCTGTAGTTTATTGCGGCT	-[2211087:2211106]	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site.	VF_1978 , VF_1977 , VF_1979	897	18083819
NC_006841.2	P35327	not specified	AAGTGTATATATTTACAGTT	-[99277:99296]	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site.	VF_A0090	897	18083819
NC_006841.2	P35327	not specified	ACCTGTAATAAACGACAGGA	+[1193321:1193340]	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site.	qsrP (VF_A1058) , VF_A1057	897	18083819

All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.

Sites are listed as curated.

AACTGTAAAATCGGACAGGT
ACCTGTAAAATCTATCAGTT
TCCTGTAGTTTATTGCGGCT
AAGTGTATATATTTACAGTT
ACCTGTAATAAACGACAGGA

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AACTGTAAAATCGGACAGGT
ACCTGTAAAATCTATCAGTT
AGCCGCAATAAACTACAGGA
AACTGTAAATATATACACTT
ACCTGTAATAAACGACAGGA

To generate the weblogo, aligned binding sites are used.

	Download data in FASTA format.
	Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
	Download raw data in TSV format. All reported sites are exported individually.
	Download data in Attribute-Relation File Format (ARFF).
	Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
	Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
	Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.